Caffery, Barbary, Joyce, Elizabeth, Miriam, Heynen, Ritter Iii, Robert, Lyndon, Jones and Michelle, Senchyna (2012) Quantification of Conjunctival TNFα mRNA Expression in Sub Populations of Human Aqueous Deficient Dry Eye. Molecular Vision.

Abstract

Abstract

Purpose: To quantify and compare conjunctival epithelial TNF mRNA expression in Sjogren’s syndrome (SS), non-Sjogren’s syndrome aqueous deficient dry eye (non-SS DE), and non-dry eye (NDE) control subjects.

Methods: 76 subjects were recruited for this study: 25 SS (confirmed via American-European Consensus Criteria 2002), 25 non-SS DE (confirmed by symptoms and Schirmer scores ≤ 10mm) and 26 NDE. Superior and temporal bulbar conjunctival epithelial cells were collected via impression cytology. Epithelial RNA was extracted and TNF gene expression was quantified by real time qPCR.

Results: TNF gene expression was found to be significantly higher in the SS group (2.48±1.79) compared to both non-SS DE (0.95±1.18; p<0.05) and NDE (0.84±0.51; p<0.05) groups. No difference in gene expression was found between the non-SS DE and NDE groups (p=NS).

Conclusions: These results demonstrate that SS-associated aqueous deficient dry eye is associated with a significant up-regulation of TNF, which is considered one of the primary mediators of inflammation. The degree to which TNF is up-regulated may contribute to the severe ocular surface damage observed in Sjogren’s syndrome.

Introduction:

Dry eye (DE) is defined as “a multifactorial disease of the tears and ocular surface that results in symptoms of discomfort, visual disturbance and tear film instability, with potential damage to the ocular surface. It is accompanied by increased osmolarity of the tear film and inflammation of the ocular surface”.(1) Two major subtypes of dry eye have been defined as “aqueous deficient” and “evaporative” (1), and these subtypes can be found clinically in isolation and in combination. Aqueous deficient dry eye is further divided into Sjogren’s syndrome (SS) and non-SS subsets. In both cases there is insufficient volume of tear secretion from the lacrimal gland, which is most often determined by a Schirmer 1 test, with the SS criterion for objective dry eye being ≤5mm of wetting of the Schirmer strip in 5 minutes. (2) Non-SS aqueous deficient dry eye is considered moderate with Schirmer 1 scores of ≤10mm in 5 minutes and severe at ≤5mm in 5 minutes. (1) Sjogren’s syndrome, especially in its primary form, is considered to be the most severe form of aqueous deficient dry eye due to the severity of symptoms and signs that usually accompany the DE, in addition to the associated systemic nature of the disease.

The major causative mechanisms underlying the reduced tear secretion from the lacrimal glands in aqueous deficient DE are not fully understood, although inflammation is believed to be a key factor, along with various hormonal and neurological influences. (3-6) To-date, relatively little is known regarding the specific inflammatory processes occurring at and within the lacrimal glands. However, data does suggest that in SS, specific infiltrative events occur in the lacrimal and salivary glands that are distinct from those in non-SS groups. (2) Whether such distinctions translate into differential disease severity, pathological mediators and/or unique targets for aqueous deficient DE treatment strategies remain unknown.

As with the lacrimal gland, the cycle of ocular surface inflammation associated with DE disease is multifactorial, complex and poorly understood.(1) As the lacrimal gland becomes inflamed, it is presumed that secreted tear fluid would contain various inflammatory mediators that could elicit an inflammatory response from the epithelia and vasculature of the ocular surface. A cascade of inflammatory events within the epithelia may also be triggered through exposure to high osmolarity, shear stress from the lids, and environmental exposure. Whether some or all of these responses are present in all forms of aqueous deficient DE remains unclear.

Characterizing both shared and unique inflammatory signalling pathways would be of benefit to better understand etiological and disease-driving mechanisms in various subsets of aqueous deficient DE, in addition to identifying appropriate targets for disease diagnosis and management. As such, significant research has taken place over the last decade to elucidate various inflammatory mediators associated with DE.

Human tear film analysis has revealed that IL-1 (7), IL-6 (8), MMP3 (7) and TNFα (9) proteins are elevated in SS samples relative to controls. IL-6 protein (9) also appears elevated in SS relative to non-SS DE tears, whereas no difference in tear TNFα protein expression between the two DE subtypes has been reported. (9). Lastly, non-SS DE tears compared to tears from healthy controls appear to contain elevated concentrations of IL-6 (9), MMP3 (7) and TNFα (9) proteins.

In addition to tears, significant insight into ocular surface inflammatory mediators has been gained from direct study of conjunctival epithelial cells collected using impression cytology. With respect to protein expression, HLA-DR has been reported to be elevated in SS compared to healthy controls (10, 11), whereas variable findings ranging from elevated to no difference have been reported from SS compared to non-SS DE. (12) (13, 14). Three previous studies have reported an elevation of HLA-DR protein expression in non-SS DE compared to healthy human controls. (11, 15, 16) Further investigation of conjunctival cells has determined that the expression of epithelial ICAM-1 protein (10), IL-6 protein (10, 17, 18), TNFα mRNA and TGF-β1 mRNA (17, 18) is elevated in SS versus control populations. In addition, expression of HLA-DR mRNA was found to be greater in an SS population compared to a non-SS DE population [18]. Taken together, biomarker data collected to date has provided evidence that inflammation does indeed play a role in various forms of DE and that distinct difference in the identity and magnitude of at least some inflammatory mediators may exist between subgroups.

To continue to add to the knowledge base in this area, our study examined the expression of conjunctival epithelial TNFα mRNA in three diverse populations: SS, non-SS aqueous deficient DE and healthy, age-matched controls. As noted above, there is some question with regards to TNFα protein expression in DE, as one study has reported higher concentrations in the tears of SS (n=8) and non-SS (n=10) DE subjects compared to control subjects (n=14), whereas no difference in SS versus non-SS DE TNFα tear concentration has also been reported (9). As quantitation of mRNA is free of the variables that confound tear protein quantitation, including lack of tear reflex interference, tear matrix effects and insufficient sample volume, we chose to place our initial focus on quantitation of mRNA. This research will add to the current published data which only includes information on 26 samples. (17, 18).

METHODS

Study Design and Subjects
Before the start of the study, ethics approval was attained from the Office of Research Ethics at the University of Waterloo and University of Toronto. All procedures adhered to the Declaration of Helsinki. Seventy-six (76) subjects were enrolled in the study: 26 control non-DE subjects, (NDE), 25 Sjogren’s subjects (SS) and 25 non-SS moderate aqueous deficient DE (non-SS DE). All participants underwent a clinical evaluation visit to determine entry eligibility, prior to a second visit in which ocular samples were collected.

SS patients were recruited from the Multidisciplinary Sjogren’s Syndrome Clinic of the University Health Network in Toronto. All SS participants had been diagnosed with primary SS using the American-European consensus criteria of 2002 (2). Thus, each of these subjects had four or more of the following criteria: symptoms and signs of dry eye and dry mouth and either a positive minor salivary gland biopsy or the presence of antibodies to Ro and/or La. No further preliminary screening was performed on this group, as all had confirmed Sjogren’s syndrome using these criteria.

The non-SS DE and NDE subjects were recruited through the SS clinic and a private practice. Subjects who answered “yes” to the question: “If you have dry eyes, have they been dry for at least 3 months?” were asked to rate their eye dryness on a visual analogue scale that is used routinely in the SS clinic. The horizontal line of the scale was marked from 0 to 10. At the 0 point the phrase “not dry at all” was written and at the 10 point “as dry as the desert”. Those subjects who scored their dryness as ≥6/10 then underwent a Schirmer I test. If their results were ≤ 10mm wetting in 5 minutes in at least one eye, they were classified as non-SS DE KCS. Non-dry eye subjects (NDE) were enrolled if they stated that they did not have dry eyes and had Schirmer I scores of >10mm in both eyes. Exclusion criteria included: a history of ocular allergy, any ocular surface disease not related to dry eye and untreated blepharitis. Subjects previously diagnosed with blepharitis were allowed to use lid scrubs and hot soaks, but were not allowed to use topical antibiotics or topical anti-inflammatories. The screening assessment for non-SS DE and NDE subjects was performed within two months of the actual clinic visit for collection of conjunctival epithelial samples. Participants were required to confirm that their dry eye status had not changed at the collection visit.

Conjunctival Impression Cytology (CIC)
Sterile Millipore, MF membranes (pore size 0.45 uM) were used in the collection of conjunctival epithelial cells. Two drops of a topical anaesthetic (Alcaine, Alcon), dosed 60 seconds apart, were applied to the right eye (only right eyes were sampled for this study). Fifteen seconds after the second drop of anaesthetic, the subject was instructed to look down, to expose the superior conjunctiva. The investigator, using sterile gloves, held the upper lid up and one piece of filter paper was placed on the superior region of the conjunctiva for five to seven seconds, then removed with blunt forceps and placed in a sterile pre-labelled 2 ml capped polypropylene centrifuge tube containing 1 mL of RLT RNA Isolation Buffer (Qiagen, Maryland, USA) with 0.01% -mercaptoethanol. A second piece of filter paper was immediately applied to the temporal conjunctiva and, after removal was placed in the same sterile tube as the first sample. All samples were immediately placed on dry ice and then transferred to -80oC for storage until processing.

RNA Isolation From CIC Samples and Reverse Transcription
Tubes containing 1 mL of RLT buffer (Qiagen) and the two impression cytology samples were allowed to thaw at room temperature and then vortexed for 30 seconds. Membranes were removed using a 21 gauge needle and samples were vortexed again and then passed through a 21 gauge needle 10 times. Extraction of total RNA proceeded according to manufacturer’s directions (RNeasy Minikit, Qiagen). The DNase step was performed as recommended. The final isolation step was conducted with 40 µL of RNAse free water and samples were stored at -80ºC.

RNA quantity and quality were assessed by measuring the optical density using a Beckman DU530 Life Science UV/Visible Spectrophotometer at 260 nm and 280 nm. cDNA was synthesized from 16 µL of RNA sample using random hexamer primers with Superscript™ III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA), according to the manufacturer’s instructions.

Real Time qPCR
Amplification of cDNA was performed in multiplex real-time PCR reactions containing target and endogenous control oligonucleotide primers in the presence of gene-specific dye-labeled Taqman probes (Table I). Two microliters of cDNA was used for amplification in a 50-µL PCR reaction containing target (300 nM) and endogenous control (100 nM) oligonucleotide primers, control and target Taqman probes (100 nM), and Taqman® Universal PCR Master Mix (Applied Biosystems, Foster City, CA, 4304437, lot L00765, exp 01/31/10). Duplicate samples were analyzed in a 7500 Real Time PCR System (Applied Biosystems, Asset No. 518030). Conditions used for amplification were as follows: 50°C for 2 minutes, followed by an initial 10 minute denaturing step at 95°C. This was followed by 40 cycles of denaturing at 95°C for 45 seconds, annealing at 60°C for 45 seconds, and extension at 72°C for 60 seconds. Reporter dye fluorescence (Rn) data exceeding a manually-set critical threshold (Ct) was collected after the extension step of each cycle in real time using a 7500 Real Time PCR System with SDS software v1.3.1 (Applied Biosystems, Foster City, CA).

A sample from a single, healthy volunteer was used to calculate the normalizing Ct. Target (TNF α) Ct data was subtracted from endogenous control (GAPDH) Ct data. This Ct value was subtracted from the Ct values calculated from study participants to generate the study statistic (Ct).

Table 1
Oligonucleotide Primers and Probes Used For Relative Expression Analysis

Gene Forward Primer Reverse Primer Taqman Probe
TNF CCCCAGGGACCTCTCTCTAA CAGCTTGAGGGTTTGCTACA 6FAM-GAGTGACAAGCCTGTAGCCC
GAPDH GAAGGTGAAGGTCGGAGTCA GACAAGCTTCCCGTTCTGAG VIC-CAATGACCCCTTCATTGACC

Data analysis
Outlying data were identified by Dixon’s Q test prior to further statistical analysis in Statistica Ver7.1 (StatSoft Inc., Tulsa, OK, USA) and Microsoft Excel™ XLfit software. All data are reported as mean ± standard deviation. Statistical differences between groups were identified by using one-way ANOVA, Dunnett’s comparison of means and by Tukey’s test. Significance was identified at p<0.05 (α = 0.05).

RESULTS

Demographics
A total of 76 subjects were enrolled into this study, and the subject demographics are displayed in Table 2. The mean age of the SS group was found to be statistically higher than the NDE group (p=0.024), but not different from the KCS group (p>0.05). Mean Schirmer I scores from both eyes collected without anaesthesia for five minutes revealed a significantly reduced (p<0.0001) tear flow in both SS (5.12 ± 5.96 mm) and KCS subjects (7.84 ± 7.35 mm), relative to NDE (23.83 ± 7.85 mm). There was no difference in mean Schirmer I scores between the KCS and SS groups (p = 0.19).

Table 2: Summary of Demographic Information for Study Groups
Group Mean Age (years) Number of Female Subjects Number of Male Subjects Total Subjects
Control Group of Non-Dry-Eyed 52.4 ± 11.4 24 2 26
KCS
59.3 ± 9.1 21 4 25
Sjogren’s Syndrome 60 ± 11.8* 21 4 25

The age of the SS group was higher than the NDE controls (*) (p=0.024)

Quantification of TNF mRNA Expression
TNF gene expression was found to be significantly higher in the SS group (2.48±1.79) compared to both non-SS DE (0.95±1.18; p<0.05) and NDE (0.84±0.51; p<0.05) groups (Figure 1). No difference in gene expression was found between the non-SS DE and NDE groups (p=NS).

Figure 1: Mean TNF mRNA expression in two distinct populations of aqueous deficient
dry eye compared to control.

Relationship of tear flow and TNF-α mRNA expression

No correlation was found between gene expression and Schirmer scores within any of the three study groups (Figures 2a to 2c). Schirmer scores from right eyes were used in correlation analysis as RNA was harvested only from right eyes.

Figure 2: Correlation between TNF mRNA expression (RQ) and Schirmer Score (mm)

(2A): Non-SS DE (Mean OD Schirmer Score = 6.7±4.8)

(2B) Non-Dry Eye Control (Mean OD Schirmer Score = 23.3±9.0)

(2C) SS Dry Eye (Mean OD Schirmer Score = 5.0±5.5).

DISCUSSION:

Our results demonstrate that expression of conjunctival epithelial TNFα mRNA expression is significantly increased in SS subjects compared to both moderate non-SS aqueous deficient dry eye and control sub-populations. No difference in TNFα mRNA expression was found when non-SS dry eye and control groups were compared. To our knowledge, this is the first time that these two distinct subgroups of aqueous deficient dry eye have been studied simultaneously with a control group. TNFα is regarded as a central mediator in human inflammatory responses (19) and has been implicated in the pathophysiology of dry eye. Our data is consistent with two previous studies that demonstrated that TNFα mRNA expression is significantly elevated in SS relative to control. (17, 18) Given the relatively abundant sample size in each of our three study groups, we can infer that at least at the genetic level, a distinctly different response occurs in SS relative to moderate DE and SS. Whether this difference translates to the protein level is unclear.

Our findings are in conflict with one study in which tear film TNFα protein was found to be similar in SS and non-SS DE. (9) Numerous explanations could account for this finding relative to our genetic findings, including differential post transcriptional modulation and the contribution from additional sources for TNF, including the lacrimal gland and leakage from conjunctival vasculature. Also of note is that our non-SS dry eye subjects do fall in the moderate dry eye category with Schirmer scores of ≤10mm. It may be that a severe form of aqueous deficient non-SS dry eye would show similarities with SS dry eye from a genetic and protein level. Ideally, a study that simultaneously quantifies mRNA and tear protein expression in each subgroup and severity category would shed light on the relative roles of gene versus protein expression of various inflammatory mediators thought to be involved in dry eye.

No correlation was found between the degree of TNFα mRNA expression and tear flow as measured through the Schirmer 1 test. Desiccation is thought to be an important factor in driving an inflammatory response at the ocular surface. As reduced volume presumably could lead to less ocular surface protection and thus greater desiccation damage, it was interesting to find no correlation. As has been noted previously, significant correlation between any two signs or symptoms of dry eye has not yet been conclusively demonstrated, owing in part to the multifactorial nature of the disease. (20) Thus, although our results clearly support the notion that TNFis a key inflammatory mediator associated with SS-dry eye, the path linking stimulus versus signs of inflammation remains elusive.

It is noteworthy that the epithelial samples analysed in this work were also used to quantify the expression of mucin genes. We have reported that clear differences in MUC1 (21) and MUC16 (22) gene expression exist in SS relative to both non-SS DE and control populations, whereas distinctions between non-SS and DE mucin expression are either absent or much reduced. Whether the sum total of regulated gene expression that occurs in SS patients reflects the increased magnitude of dry eye severity and/or different pathophysiological pathways remains to be determined.

It should be noted that the mean age of the SS group in our study was statistically higher than the NDE group. It is known that tear volume, production, stability and /or quality is reduced in the older population. (23, 24) However, whether the difference between our two study groups (60 vs 52) is relevant is questionable, as the age comparison for such changes in tear stability generally refers to populations <30 years of age relative to those older than 50. In addition, the impact of age on mRNA expression is not known. With respect to dry eye status, tear secretion data collected from Schirmer I suggests that both the SS and non-SS DE groups in our study were aqueous deficient dry eye, lending to the validity of our comparison. In addition, a critical comparison in this work was between the two sub-populations of dry eye, which were age and sex matched.

In summary, our results conclude that expression of conjunctival epithelial TNFα mRNA is significantly elevated in a SS population relative to both non-SS and control populations and that no difference in expression was found between non-SS DE versus control. These data support the severe clinical presentation of dry eye in the SS population.

References

1. Lemp M, Baudouin C, Baum J, Dogru M, Foulks G, Kinoshita S, et al. The definition and classification of dry eye disease: Report of the Definition and Classification Subcommittee of the international Dry Eye Workshop (2007). Ocul Surf 2007;5:75-92.
2. Vitali C, Bombardieri S, Jonsson R, Moutsopoulos H, Alexander E, Carsons S, et al. Classification criteria for Sjogren's syndrome: a revised version of the European criteria proposed by the American-European Consensus Group. Ann Rheum Dis 2002;61:554-558.
3. Williamson J, Gibson A, Wilson T, Forrester J, Whaley K, Dick W. Histology of the lacrimal gland in keratoconjunctivitis sicca. British Journal of Ophthalmology 1973;57:852.
4. Konttinen Y, Sorsa T, Hukkanen M, Segerberg M, Kuhlefelt-Sundstrom M, Malmstrom M, et al. Topology of innervation of the salivary glands by protein gene product 9.5 and synaptophysin immunoreactive nerves in patients with Sjogren's syndrome. J Rheumatol 1992;19:30-37.
5. Walcott B, Brink P. Age-related decrease in the innervation density of the lacrimal gland in mouse models of the Sjogren's syndrome. In: Sullivan DA DD, Meneray MA, editor. Lacrimal Gland, Tear Film and Dry Eye Syndrome 2. New York: Plennum; 1998. p. 917-923.
6. Andoh Y, Shimura S, Sawai T, Sasaki H, Takashimi T, Shirato K. Morphometric analysis of airways in Sjogren's syndrome. Am Rev Respir Dis 1993;148:1358-1362.
7. Solomon A, Dursun D, Liu Z, Xie Y, Macri A, Pflugfelder S. Pro- and anti-inflammatory forms of interleukin-1 in the tear fluid and conjunctiva of patients with dry-eye disease. Invest Ophthalmol Vis Sci 2001;42:2283-2292.
8. Tishler M, Yaron I, Geyer O, Shirazi I, Naftaliev E, Yaron M. Elevated tear interleukin-6 levels in patients with Sjogren's syndrome. Ophthalmology 1998;105:2327-2329.
9. Yoon K-C, Jeong I-Y, Park Y-G, Yang S-Y. Interleukin-6 and tumor necrosis factor-alpha levels in tears of patients with dry eye syndrome. Cornea 2007;26:431-437.
10. Jones D, Yen M, Pflugfelder, SC, Crouse CA, Atherton SS, Monroy D, Ji X, Atherton S, Pflugfelder S. Evaluation of cytokine expression in the conjunctival epithelia of Sjogren's syndrome patients. Invest Ophthalmol Vis Sci 1994;35:3493-3504.
11. Brignole F, Pisella P, Goldchild M, De Saint Jean M, Goguel A, Baudouin C. Flow cytometric analysis of inflammatory markers in conjunctival epithelial cells of patients with dry eyes. Invest Ophthalmol Vis Sci 2000;41:1356-1363.
12. Tsubota K, Fujihara T, Saito K, Takeuchi T. Conjunctival epithelium expression of HLA-DR in dry eye patients. Ophthalmologica 1999;213:16-19.
13. Baudoin C, Brignole F, Pisella P, De Saint Jean M, Goguel A. Flow cytometric analysis of the inflammation marker HLA-DR in dry eye syndrome: results from 12 months of randomized treatment with topical cyclosporine. In: Sullivan D, Stern M, Tsubota K, Dartt D, Sullivan R, Bromberg B, editors. Lacrimal gland, tear film, and dry eye syndromes 3. New York: Kluwer Academic/Plenum; 2002. p. 761-769.
14. Stern M, Gao J, Schwalb T, Ngo M, Tieu D, Chan C-C, et al. Conjunctival T-cell subpopulations in Sjogren's and non-Sjogren's patients with dry eye. Invest Ophthalmol Vis Sci 2002;43:2609-2614.
15. Pisella P, Brignole F, Debbasch C, Lozato P, Creuzot-Garcher C, Bara J, et al. Flow cytometric analysis of conjunctival epithelium in ocular rosacea and keratoconjunctivitus sicca. Ophthalmology 2000;107:1841-1849.
16. Rolando M, Barabino S, Mingari C, Moretti S, Giuffrida S, Calabria G. Distribution of conjunctival HLA-DR expression and the pathogenesis of damage in early dry eyes. Cornea 2005;24:951-954.
17. Jones D, Monroy D, Ji Z, Pflugfelder S. Alterations of ocular surface gene expression in Sjogren's syndrome. In: Sullivan D, Dartt D, Meneray M, editors. Lacrimal Gland, Tear Film, and Dry Eye Syndromes 2. New York: Plenum Press; 1998. p. 533-536.
18. Pflugfelder S, Jones D, Ji Z, Afonso A, Monroy D. Altered cytokine balance in the tear fluid and conjunctiva of patients with Sjogren's syndrome keratoconjunctivitis sicca. Curr Eye Res 1999;19:201-211.
19. Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. Molecular Biology of the Cell. In. 4th ed. New York: Garland Science; 2002. p. 831-906.
20. Nichols K, Nichols J, Mitchell G. The relation between tear film tests in patients with dry eye disease. Ophthal Physiol Optics 2003;23:553-560.
21. Caffery B, Heynen M, Joyce E, Jones L, Ritter R, Senchyna M. MUC1 expression in Sjogren's syndrome, KCS, and control subjects. Mol Vis 2010;16:1720-1724.
22. Caffery B, Joyce E, Heynen M, Jones L, Ritter R, Gamache D, et al. MUC16 expression in Sjogren's syndrome, KCS, and control subjects. Mol Vis 2008;14:2547-2555.
23. Mathers W, Lane J, Zimmerman M. Tear film changes associated with normal aging. Cornea 1996;15:229-234.
24. Patel S, Farrell J. Age related changes in pre-corneal tear film stability. Optom Vis Sci 1989;66:175-178.

Figure 1: Mean TNF mRNA expression in two distinct populations of aqueous deficient
dry eye compared to control.

The SS population had significantly higher expression on TNFα mRNA compared to the NDE controls (#) and non-SS DE group (#). No difference was found between the NDE controls and non-SS DE group.

Figure 2: Correlation between TNF mRNA expression (RQ) and Schirmer Score (mm)

2A: no significant correlation between Schirmer scores in non-SS DE and concentration of TNFα mRNA.

2B: no significant correlation in NDE controls between Schirmer scores and concentration of TNFα mRNA.

2C: no significant correlation in SS DE between Schirmer scores and concentration of TNFα mRNA.

Item Type:	Article
Date Deposited:	13 Oct 2015 13:14
Last Modified:	13 Oct 2015 13:14
URI:	https://oak.novartis.com/id/eprint/7900